ACGTTGCAAGTCCGATTGACCAGTTCAGGATCGAACGTTGCAAGTCCGATTGACCAGTTCAGGATCGAACGTTGCAAGTCCGATTGACCAGTTCAGGATCGAACGTTGCAAGTCCGATTGACCAGTTCAGGATCGA
TGCAACGGTTACGCATGGCATCGGATCCAATGCAACGGTTACGCATGGCATCGGATCCAATGCAACGGTTACGCATGGCATCGGATCCAATGCAACGGTTACGCATGGCATCGGATCCAA
GGATCCGTAACGTTAGCCATGACTGGATCCGTAACGTTAGCCATGACTGGATCCGTAACGTTAGCCATGGATCCGTAACGTTAGCCATGACTGGATCCGTAACGTTAGCCATGACTGGATCCGTAACGTTAGCCAT
CATGGCATTGACCGTAACGGTTCAGCATGGCATTGACCGTAACGGTTCAGCATGGCATTGACCGTAACATGGCATTGACCGTAACGGTTCAGCATGGCATTGACCGTAACGGTTCAGCATGGCATTGACCGTAA
GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA
ACGTTGCAAGTCCGATTGACCAGTTCAGGATCGAACGTTGCAAGTCCGTGCAACGGTTACGCATGGCATCGGATCCAATGCAACGGTTACGCATGGACGTTGCAAGTCCGATTGACCAGTTCAGGATCGAACGTTGCAAGTCCGTGCAACGGTTACGCATGGCATCGGATCCAATGCAACGGTTACGCATGG
SPARKbiom MedLab

SPARKbiom Test Specifications

The SPARKbiom test involves the analysis of biological material using the latest third-generation DNA sequencing method (long-read), carried out with the Oxford Nanopore Technologies platform and the most up-to-date version of reagents currently available.

We identify over 120,000 species of bacteria and 100,000 species of eukaryotic organisms.

Sample reports

Additional materials

I. Test

Test Method and Scope

The SPARKbiom test is a comprehensive analysis of the microbiological composition of a sample using advanced third-generation sequencing technology (Oxford Nanopore, Q14 chemistry). Our proprietary methodology enables precise identification of bacteria, fungi, and parasites, covering full variable regions of the 16S rRNA gene and selected eukaryotic markers.

II. TECHNOLOGY

Unique attributes of the SPARKbiom test

Spark-Tech's proprietary technologies, available only within the SPARKbiom framework.

Spark-Tech’s proprietary PCR primers.

A proprietary set of primers, verified for complementarity (minimum 95% match). It enables the amplification of over 120,000 bacterial species and 100,000 species of eukaryotic organisms. The primers are covered by a patent application filed by Spark-Tech sp. z o.o.

Reference database - over 1.2 million sequences

A database developed by Spark-Tech based on the reputable NCBI Nucleotide repositories, with the option to add additional reference sequences. The database includes a standardized taxonomic classification.

Most comprehensive detection panel available

High-resolution third-generation amplicon sequencing, covering bacteria, fungi, and parasites, enables highly accurate determination of the relative abundance of individual living organisms in a sample.

Spark-Tech’s proprietary taxonomic identification algorithm

Algorithms developed by Spark-Tech assign sequenced DNA to individual microorganism species using a database of 1.2 million reference sequences. Our results are fully consistent with the NCBI BLAST service.

III. Methodology

Detailed Methodology of the SPARKbiom Test

PCR amplification of entire gene fragments that differentiate individual microorganisms (16S, 18S rRNA) is performed using proprietary universal primers developed by Spark-Tech (Spark-Tech molecular probe technology).

Third-generation sequencing (long-read) uses the latest available version of reagents (Q14 chemistry) and software from Oxford Nanopore Technologies. Quantitative identification of the species composition of bacteria, fungi, and parasites is performed using Spark-Tech technology, equivalent to the NCBI BLAST algorithm.

Sequence alignment parameters

The analysis method used allows for the determination of the following parameters:

— For the entire sequence, based on Q-score (with a standard threshold above Q15)

— For individual nucleotides within the sequence (with a standard threshold above Q5)

— Based on the percentage identity to the reference sequence (standardly 95%)

The matching uses the full BLAST algorithm, which is more accurate than the commonly used simplified algorithms uBLAST and Centrifuge. A description of the sequencing methodology in Polish or English is available for scientific publication purposes.

IV. Result

SPARKbiom Test Reports

Depending on the purchased package, the test results include one or more of the following reports:

RAPORT 1

Taxonomic Report

Identification of the microbial composition of the sample

A complete taxonomic analysis of the microbiome with identification of bacteria, fungi, and parasites at the species level. The report includes the percentage composition of the microbiota, dysbiosis index, diversity metrics, and identification of potentially pathogenic organisms.

REPORT OVERVIEW

● Graphical representation of microbiota composition

● Detailed analysis of individual microorganisms

● Assessment of dysbiosis and its severity

● Identification of potentially pathogenic organisms

● Data in CSV/XLSX formats and a graphical PDF report

RAPORT 2

Functional analysis of the microbiome

13 koszyków funkcjonalnych - algorytm PICRUSt2

Analiza funkcjonalna oparta na szczegółowej identyfikacji taksonomicznej umożliwia wnioskowanie o potencjalnych zdolnościach funkcjonalnych mikrobiomu. Na podstawie algorytmu PICRUSt2 oceniane jest 13 koszyków klinicznych, a wyniki porównywane z kohortą 600+ osób.

13 KOSZYKÓW FUNKCJONALNYCH:

01. Carbohydrate fermentation and SCFA production — butyrate, propionate, and acetate production pathways; lactate balance.
02. B-group vitamins — B12 synthesis and absorption balance, folate production, and drug interaction proxies.
03. Carbohydrates and the intestinal barrier — dietary fiber, mucin degradation, and the Akkermansia context.
04. Bile acids and the estrobolome — BSH function, bai operon activity, and HSD modulation.
05. Oxalates - risk of nephrolithiasis — type I and II degradation, Oxalobacter index.
06. Choline and TMAO - cardiovascular risk — TMA production (CutC/CntAB), TMAO amplification.
07. The microbiome-mitochondria axis — antioxidant defense, toxin burden, NAD support.
08. Sulfur metabolism and hydrogen sulfide (H₂S) toxicity — sulfite reductase, sox detoxification.
09. Inflammatory structures, LPS, and biofilm — lipid A biosynthesis, TLR4 immunogenicity, E. coli markers.
10. Psychobiotics and neuromodulators — GABA production, tryptophan–kynurenine bifurcation, dopamine.
11. Protein and nitrogen metabolism — urease/ammonia axis, biogenic amines, uremic toxins.
12. Methanogenesis with MetaIndex — hydrogenotrophic and methylotrophic pathways, MCR gold standard.
13. Metaboliczny Koszyk Diety — ocena potencjału do metabolizowania różnych grup substancji odżywczych — błonnika, skrobi, polifenoli, laktozy, tłuszczów, fitoestrogenów itd.
RAPORT 3

Medical recommendations

AI-based clinical and dietary recommendations

Medical recommendations is a report that transforms the SPARKbiom test result into a physician-grade document. Based on comprehensive taxonomic data and PICRUSt2 functional analysis, a physician, supported by a multi-stage AI system, develops recommendations that integrate the microbiome profile with the patient’s clinical context.

REPORT OVERVIEW

● Customized probiotic recommendation

● Personalized dietary recommendations organized into distinct phases

● Supplementation recommendations

● List of recommended targeted tests

● Clinical context including medications, diagnoses, and medical history